Exercícios Disciplina Biologia Molecular (Biologia)



Baixar 9.12 Kb.
Encontro26.03.2018
Tamanho9.12 Kb.

Exercícios
Disciplina Biologia Molecular (Biologia)

Prof. Francisco Prosdocimi

> Seqüência 1

GCCTTCAATGGCAAGCGGTCTGGAATCCTACTTCTTGAATCGGCACGGTGTCATTACGGGCGGGGGCCAG

AACAACGTCCCTGGACATCACACCTAGCCCGTGCGACGGCGGAAACCTTCGCCGGCGCAGGCTTCGACGT

GACCCTCATCGCGGAACCCTCCCCCACCCCAGTGTTGGCGTGGCTGGTGCGCTCACGGCGAATGGACGTG

GGCGTGCAGATCACCGCCTCGCACAATCGAATTCAGGACAACGGCTACAAGCTGTACCTGGACGGCGGCT

CTCAGCTGGTCTCCCCCGCCGACCGGCAGATCGAGGAGCACATTGCCGCCCAGCCAACTGACGCGGCGAA

GATCCCCCGCTCCGAGGCGAAGTCTGTAGACCTGTCCGTAGTCTCCGGCTATGTCACCGAGCTAAGTACC

CTGGTGGCCACCGGCCGCCAATCCGAGCTGGCGCCGCGGCGGAAGCTGAAGATCCTCTACACCCCCATGC

ACGGCGTGGGCGGCAATGCCCTGGAGTGGGCCTTACGTGAATTCGGCTTCGGCAACGTGCACGCGGTGGC

CTCGCAGCGCTGGCCGGACCCGACCTTCCCGACTGTGGACTTCCCCAACCCTGAGGAGCCGGGTGCCACC

GACGCGCTGCTGGAAGAAGCCCGCGCCATCGATGCGGACCTGCTGATCGCCCTGGATCCGGATGCGGACC

Questão 1. Suponha que a seqüência acima tenha sido obtida de um extrato bacteriano. Uma vez conhecida a seqüência deste gene, queremos agora cloná-lo em um vetor de clonagem. Para isso precisamos primeiro cortá-la com enzimas de restrição. Sabe-se que a enzima de restrição EcoRI corta um DNA fita dupla do seguinte modo e no seguinte sítio (veja figura). Responda:

a) Quantos sítios de restrição existem na nossa seqüência? Sublinhe-os.

b
Figura: Corte com a enzima EcoRI
) O gel abaixo apresenta, na canaleta 1, um padrão de peso molecular onde as bandas representam seqüências com 50bp, 80bp, 200bp e 1Kb. Suponha que seu DNA acima tenha sido digerido pela enzima EcoRI e represente, na canaleta 2, os fragmentos resultantes do corte (Dica: cada linha da seqüência apresenta 70 bases).

c) Utilizaremos aqui um plasmídeo chamado pLADA contendo 900bp que apresenta um sítio para a enzima EcoRI dentro de seu sítio múltiplo de clonagem. O plasmídeo foi digerido com esta enzima de restrição e, assim, linearizado. Suponha que você tenha purificado do gel seu maior fragmento obtido na canaleta 2 e incubado este fragmento com o plasmídeo digerido, na presença de DNA ligase. Na canaleta 3, apresente as bandas resultantes deste experimento de ligação. Lembre-se que o plasmídeo pode ligar-se com ou sem o inserto. Explique porque as bandas têm o tamanho observado no gel.

_____________________________________________________________________________________

d) Invente uma enzima de restrição que corte num sítio diferente da EcoRI. Lembre-se que as enzimas de restrição cortam em sítios palindrômicos (idênticos nas duas fitas; GAATTC é GAATTC também na fita complementar-reversa). Apresente o sítio de corte de sua enzima, dê um nome para ela, corte o DNA da seqüência 1 com esta enzima em pelo menos um sítio e apresente, na canaleta 4, os fragmentos gerados por este ensaio de digestão, com seus respectivos tamanhos.

Enzima:__________________

Sítio de corte: _______________________________



Número e tamanho dos fragmentos de restrição gerados_____________________________



Compartilhe com seus amigos:


©ensaio.org 2017
enviar mensagem

    Página principal